Natural history of C282Y homozygotes for hemochromatosis: PATIENTS AND METHODS Part 2

In: Hemochromatosis

25 May 2012

Genetic testing

HemochromatosisGenetic testing for the C282Y mutation was done by restriction enzyme gel digestion polymerase chain reaction using sense primer 5’TGGCAAGGGTAAACAGATCC and antisense primer 5’TACCTCCTCAGGCACTCCTC. These primers were used to avoid the potential mistyping in the presence of a 5569A polymorphism that has been described. Online shopping will cost you less money and will take less time, because you can find efficient birth control alesse with generous discounts at the pharmacy that proved its reputability and desire to help by offering best level of service and most efficient drugs.

Statistical analysis

Differences in survival between groups were assessed with the Kaplan-Meier life-table method (Winstat, USA). The survival curve in the 277 C282Y homozygotes was compared with their expected survival curve derived from provincial life-table data matched for age and sex (Figure 1).

Cumulative survival rates of subjects who are homozygous
Figure 1) Cumulative survival rates of subjects who are homozygous for the C282Y mutation in the hemochromatosis gene. Long term survival was significantly lower in cirrhotic (n=40) than in noncirrhotic C282Y homozygotes (n=237) (P

The risk factors affecting survival were studied using sequential, backward stepwise proportional hazards regression (SAS software, SAS Institute, USA).


About this blog

Blog invites submissions of review articles, reports on clinical techniques, case reports, conference summaries, and articles of opinion pertinent to the control of pain and anxiety in dentistry.

Photostream

Mount Sinai Medical Center
Momordica balsamina (Balsam Apple)
Momordica balsamina (Balsam Apple)
Momordica balsamina (Balsam Apple)
Discover : The Edge - Multipurpose Powerpoint Template
Discover : River Presentation Template
Morinda citrifolia (Noni)
Morinda citrifolia (Noni)
Morinda citrifolia (Noni)

Tags